Silantes offers oligonucleotid synthesis of RNA and DNA
labeled with the stable isotopes 2H, 13C and 15N, having 98% of isotopic enrichment and HPLC-pure.

 

 

Many parameters, such as type of isotopes required, length and amount of the oligo,
the sequence and ease of purification influence the price. Therefore, Silantes calculates the cost for each case individually.

Send your specific request to us - we will send you a quotation promptly.

 

For the synthesis of a specific oligonucleotide the following information is needed:

- Sequence of the desired oligonucleotide
- RNA or DNA
- Labeling
- Amount needed

 

 

Example of a project performed by Silantes
Synthesis of an E. coli promotor sequence 23-mer:

Sequence: d(GGGACACGGCGAATAGCCATCCC)
Labeling: 13C and 15N (>98%)
Purity: > 90%
Amount: 1mg
Our price for the production of this 23-mer oligonucleotide was 2,380 Euro.

 

 

Please do not hesitate to contact us at:

Silantes GmbH, Gollierstrasse 70 c
D–80339 München, Germany
Tel.: + 49 (0) 89 - 500 941 - 0
Fax: + 49 (0) 89 - 500 941 - 29
http://www.silantes.com
e-mail: info@silantes.com

 

Silantes GmbH I Gollierstr. 70 c I 80339 München I Germany